Ncapd3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ncapd3^em1(IMPC)J
• Name: non-SMC condensin II complex, subunit D3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357830
• Synonyms: Ncapd3^-
• Gene: Ncapd3 Location: Chr9:26941471-27006611 bp, + strand Genetic Position: Chr9, 12.12 cM, cytoband A4
• Alliance: Ncapd3^em1(IMPC)J page
• IMPC: Ncapd3 gene page

Ncapd3^em1(IMPC)J/Ncapd3^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGTATGACGGGAGTACAA and AAGAGCGTCAGACAAACCAC, which resulted in a 494 bp deletion beginning at Chromosome 9 position 27,036,876 bp and ending after 27,037,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000266248 (exon 3) and 339 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ncapd3 Mutation: 90 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)