Dzip1l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dzip1l^em1(IMPC)J
• Name: DAZ interacting protein 1-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357885
• Gene: Dzip1l Location: Chr9:99511549-99551309 bp, + strand Genetic Position: Chr9, 51.93 cM, cytoband F1
• Alliance: Dzip1l^em1(IMPC)J page
• IMPC: Dzip1l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTAGATCCCCCAGACAGCG and CTACAGATGAGGCTACAGGG, which resulted in a 390 bp deletion beginning at Chromosome 9 position 99,639,764 bp and ending after 99,640,153 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219920 (exon 3) and 305 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 167 and early truncation 41 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dzip1l Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)