Rnf217^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf217^em1(IMPC)J
• Name: ring finger protein 217; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357892
• Gene: Rnf217 Location: Chr10:31377883-31485721 bp, - strand Genetic Position: Chr10, 17.45 cM
• Alliance: Rnf217^em1(IMPC)J page
• IMPC: Rnf217 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCAGGGCATATAAGTCAG and GCCATGTTACAGGATCATAA, which resulted in a 2551 bp deletion beginning at Chromosome 10 position 31,503,602 bp and ending after 31,506,152 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463122 and ENSMUSE00000464525 (exons 4 and 5) and 2237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 400 and truncation 55 amino acids later by read through into the 3 UTR. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rnf217 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)