Specc1l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Specc1l^em1(IMPC)J
• Name: sperm antigen with calponin homology and coiled-coil domains 1-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357905
• Gene: Specc1l Location: Chr10:75047872-75148234 bp, + strand Genetic Position: Chr10, 38.51 cM
• Alliance: Specc1l^em1(IMPC)J page
• IMPC: Specc1l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGATACTTTTATCATGTCG and TTTGAGGAGATCTTTCAGCA, which resulted in a 408 bp deletion beginning at Chromosome 10 position 75,230,598 bp and ending after 75,231,005 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001237072 (exon 4) and 218 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Specc1l Mutation: 51 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)