About   Help   FAQ
Cldn23em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cldn23em1(IMPC)J
Name: claudin 23; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6357940
Gene: Cldn23  Location: Chr8:36291866-36293713 bp, - strand  Genetic Position: Chr8, 21.21 cM, cytoband B1.1
Alliance: Cldn23em1(IMPC)J page
IMPC: Cldn23 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTACAGGTCGGAGTCACA and GACGCCGGTGGTGATGACGC, which resulted in a 860 bp deletion beginning at Chromosome 8 position 35,825,454 bp and ending after 35,826,313 bp (GRCm38/mm10). This mutation deletes 860 bp of ENSMUSE00000448200 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cldn23 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory