Cldn23^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cldn23^em1(IMPC)J
• Name: claudin 23; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357940
• Gene: Cldn23 Location: Chr8:36291866-36293713 bp, - strand Genetic Position: Chr8, 21.21 cM, cytoband B1.1
• Alliance: Cldn23^em1(IMPC)J page
• IMPC: Cldn23 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTACAGGTCGGAGTCACA and GACGCCGGTGGTGATGACGC, which resulted in a 860 bp deletion beginning at Chromosome 8 position 35,825,454 bp and ending after 35,826,313 bp (GRCm38/mm10). This mutation deletes 860 bp of ENSMUSE00000448200 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cldn23 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)