Tktl2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tktl2^em1(IMPC)J
• Name: transketolase-like 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357997
• Gene: Tktl2 Location: Chr8:66964408-66970987 bp, + strand Genetic Position: Chr8, 33.14 cM, cytoband B3.3
• Alliance: Tktl2^em1(IMPC)J page
• IMPC: Tktl2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGCGCAGACTTTCCTCAA and TGATTGCAAAGTTTTATGAT, which resulted in a 2265 bp deletion beginning at Chromosome 8 position 66,511,711 bp and ending after 66,513,975 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000151364 (exon 1) and 244 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tktl2 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)