About   Help   FAQ
Tktl2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tktl2em1(IMPC)J
Name: transketolase-like 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6357997
Gene: Tktl2  Location: Chr8:66964408-66970987 bp, + strand  Genetic Position: Chr8, 33.14 cM, cytoband B3.3
Alliance: Tktl2em1(IMPC)J page
IMPC: Tktl2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGCGCAGACTTTCCTCAA and TGATTGCAAAGTTTTATGAT, which resulted in a 2265 bp deletion beginning at Chromosome 8 position 66,511,711 bp and ending after 66,513,975 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000151364 (exon 1) and 244 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tktl2 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/21/2024
MGI 6.24
The Jackson Laboratory