Slc16a11^em1Smoc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc16a11^em1Smoc
• Name: solute carrier family 16 (monocarboxylic acid transporters), member 11; endonuclease-mediated mutation 1, Shanghai Model Organisms Center
• MGI ID: MGI:6358784
• Gene: Slc16a11 Location: Chr11:70104717-70107239 bp, + strand Genetic Position: Chr11, 42.99 cM
• Alliance: Slc16a11^em1Smoc page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology targeted the first exon (guide RNA sequences: GCCGCAGCATTCGCCGTGAA+CGG) and generated a 38 bp deletion (CGTAGGAGAGCCCGTTCACGGCGAATGCTGCGGCCGCC) resulting in a frame shift that is expected to produce a truncated protein with 33 amino acids. Expression of the mRNA is only about 10% of that of wild-type and Western blot analysis confirmed absence of protein in livers due to nonsense-mediated decay of mRNA. (J:278098)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc16a11 Mutation: 18 strains or lines available

References

• Original: J:278098 Zhao Y, et al., Gain-of-Function Mutations of SLC16A11 Contribute to the Pathogenesis of Type 2 Diabetes. Cell Rep. 2019 Jan 22;26(4):884-892.e4
• All: 1 reference(s)