Gk2^em#Juhu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gk2^em#Juhu
• Name: glycerol kinase 2; endonuclease-mediated mutation, Junjiu Huang
• MGI ID: MGI:6359789
• Synonyms: Gk2^-, Gk2 KO
• Gene: Gk2 Location: Chr5:97603001-97604880 bp, - strand Genetic Position: Chr5, 47.71 cM
• Alliance: Gk2^em#Juhu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele represents a pool of two possible out-of frame deletion null alleles created using an sgRNA (TTGGAAGGCGTGCCAATATC) and CRISPR/Cas9 technology: a two-base deletion of reverse strand AT (c.759_760del) (Gk2^em1Juhu) and/or a 14-base deletion of reverse strand CCAATATCTGGATG (c.754_767del) (Gk2^em2Juhu). This allele is used where the specific allele or allele combination is not specified. (J:278636)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gk2 Mutation: 20 strains or lines available

References

• Original: J:278636 Chen Y, et al., Glycerol kinase-like proteins cooperate with Pld6 in regulating sperm mitochondrial sheath formation and male fertility. Cell Discov. 2017;3:17030
• All: 1 reference(s)