Gykl1^em#Juhu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gykl1^em#Juhu
• Name: glycerol kinase-like 1; endonuclease-mediated mutation, Junjiu Huang
• MGI ID: MGI:6359801
• Synonyms: Gykl1^-, Gykl1 KO
• Gene: Gykl1 Location: Chr18:52826762-52828622 bp, + strand Genetic Position: Chr18, 28.25 cM
• Alliance: Gykl1^em#Juhu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: This allele represents a pool of two possible out-of frame insertion null alleles created using an sgRNA (AGCGGGAAACTACGATAGTC) and CRISPR/Cas9 technology: a single base insertion of an A (c.294dup) (Gykl1^em1Juhu) and/or a 236-base insertion (c.290_291ins236) (Gykl1^em2Juhu). This allele is used where the specific allele or allele combination is not specified. (J:278636)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gykl1 Mutation: 12 strains or lines available

References

• Original: J:278636 Chen Y, et al., Glycerol kinase-like proteins cooperate with Pld6 in regulating sperm mitochondrial sheath formation and male fertility. Cell Discov. 2017;3:17030
• All: 1 reference(s)