Tmprss11f^em1Nju
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmprss11f^em1Nju
• Name: transmembrane protease, serine 11f; endonuclease-mediated mutation 1, Model Animal Research Center for Nanjing University
• MGI ID: MGI:6360461
• Gene: Tmprss11f Location: Chr5:86669757-86780283 bp, - strand Genetic Position: Chr5, 43.56 cM
• Alliance: Tmprss11f^em1Nju page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting of exon 4 deleted 20 bp (AGTCACAAGCATCAAATACA) resulting in non-coding frameshift starting in the SEA domain in the extracellular region. (J:274100)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmprss11f Mutation: 39 strains or lines available

References

• Original: J:274100 Zhang Z, et al., The Transmembrane Serine Protease HAT-like 4 Is Important for Epidermal Barrier Function to Prevent Body Fluid Loss. Sci Rep. 2017 Mar 24;7:45262
• All: 1 reference(s)