Pgap1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pgap1^em1(IMPC)J
• Name: post-GPI attachment to proteins 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6360661
• Gene: Pgap1 Location: Chr1:54512159-54596843 bp, - strand Genetic Position: Chr1, 27.25 cM
• Alliance: Pgap1^em1(IMPC)J page
• IMPC: Pgap1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAGGGGGAATAGATTATAG and AGTTATCGTTTTTCACGCAG, which resulted in a 615 bp deletion beginning at Chromosome 1 position 54,550,691 bp and ending after 54,551,305 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000602220 (exon 2) and 461 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 69 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pgap1 Mutation: 53 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)