About   Help   FAQ
Nap1l3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nap1l3em1(IMPC)J
Name: nucleosome assembly protein 1-like 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6360667
Gene: Nap1l3  Location: ChrX:121304257-121307082 bp, - strand  Genetic Position: ChrX, 49.81 cM
Alliance: Nap1l3em1(IMPC)J page
IMPC: Nap1l3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCTGAAGTCATGGTAGT and TCACAGAACCTGGTGCCCAT, which resulted in a 1549 bp deletion beginning at Chromosome X position 122,395,429 bp and ending after 122,396,977 bp (GRCm38/mm10). This mutation deletes 1549 bp of ENSMUSE00000471845 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nap1l3 Mutation:  7 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/21/2024
MGI 6.24
The Jackson Laboratory