Necap2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Necap2^em1(IMPC)J
• Name: NECAP endocytosis associated 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6360669
• Gene: Necap2 Location: Chr4:140793823-140805668 bp, - strand Genetic Position: Chr4, 73.35 cM
• Alliance: Necap2^em1(IMPC)J page
• IMPC: Necap2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGTTTGTCCAGGGAACAA and CTACAGGCCATAGGCCCACA, which resulted in a 522 bp deletion beginning at Chromosome 4 position 141,073,465 bp and ending after 141,073,986 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254927 and ENSMUSE00001278646 (exons 3 and 4) and 335 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Necap2 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)