Ykt6em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ykt6em1(IMPC)J |
Name: |
YKT6 v-SNARE homolog (S. cerevisiae); endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6360693 |
Synonyms: |
Ykt6- |
Gene: |
Ykt6 Location: Chr11:5905779-5917780 bp, + strand Genetic Position: Chr11, 3.89 cM
|
Alliance: |
Ykt6em1(IMPC)J page
|
IMPC: |
Ykt6 gene page |
|
Ykt6em1(IMPC)J/Ykt6em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and are dead after 72hr in vitro outgrowth culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCACACTGTCCCCAACACAG and TGGATAGGAGAAGCAAGGCG, which resulted in a 248 bp deletion beginning at Chromosome 11 position 5,959,240 bp and ending after 5,959,487 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000105087 (exon 2) and 165 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 19 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|