Gm5447^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm5447^em1(IMPC)J
• Name: predicted gene 5447; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6360721
• Gene: Gm5447 Location: Chr13:31158147-31160231 bp, + strand Genetic Position: Chr13, 13.33 cM
• Alliance: Gm5447^em1(IMPC)J page
• IMPC: Gm5447 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTGCCCAAGAGTCCACAG and CCATAAGCCCTAAGGTTTGA, which resulted in a 211 bp deletion beginning at Chromosome 13 position 30,974,433 bp and ending after 30,974,643 bp (GRCm38/mm10). This mutation deletes 211 bp of non-coding ENSMUSE00000431669 (exon 1) and is predicted to result in disruption of the regulatory build in this genome region. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gm5447 Mutation: 3 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)