Aatf^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aatf^em1(IMPC)J
• Name: apoptosis antagonizing transcription factor; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6361005
• Synonyms: Aatf^-
• Gene: Aatf Location: Chr11:84313681-84404348 bp, - strand Genetic Position: Chr11, 51.3 cM, cytoband B5
• Alliance: Aatf^em1(IMPC)J page
• IMPC: Aatf gene page

Aatf^em1(IMPC)J/Aatf^em1(IMPC)J mice exhibit embryonic lethality by E3.5. Morula-like embryos fail to hatch from the zona pellucida in vitro.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTCGCTTTTATATTTAAC and ATAAGCAAGATAGCAGCACG, which resulted in a 427 bp deletion beginning at Chromosome 11 position 84,472,923 bp and ending after 84,473,349 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001250419 (exon 6) and 312 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 244 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Aatf Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)