Cdc37^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdc37^em1(IMPC)J
• Name: cell division cycle 37; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6361011
• Synonyms: Cdc37^-
• Gene: Cdc37 Location: Chr9:21050727-21061230 bp, - strand Genetic Position: Chr9, 7.72 cM, cytoband A3
• Alliance: Cdc37^em1(IMPC)J page
• IMPC: Cdc37 gene page

Cdc37^em1(IMPC)J/Cdc37^em1(IMPC)J mice exhibit embryonic lethality, with no embryos detected at E7.5 and lower number of embryos than expected at E3.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGATGGCAGATGGCCAGG and TCTGGTCCCCTGTGGTAGCA, which resulted in a 2,555 bp deletion beginning at Chromosome 9 position 21,140,717 bp and ending after 21,143,271 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000217364 through ENSMUSE00000217367 (exons 2-7) and 1673 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 due to the deletion of 295 amino acids but remains in frame for the last 50 amino acids. There is an additional 1bp (A) deletion 3 bp upstream of the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdc37 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)