Npcd^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Npcd^em1(IMPC)J
• Name: neuronal pentraxin chromo domain; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6361116
• Gene: Npcd Location: Chr15:79673876-79718438 bp, - strand Genetic Position: Chr15, 37.85 cM
• Alliance: Npcd^em1(IMPC)J page
• IMPC: Npcd gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTCTGGCTGGAACTTCCAG and TGAGATAGTGAAGCTATGGC, which resulted in a 396 bp deletion beginning at Chromosome 15 position 79,794,197 bp and ending after 79,794,592 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001205348 (exon 5) and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 78 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Npcd Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)