H2-Eb2^b-em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: H2-Eb2^b-em1(IMPC)J
• Name: histocompatibility 2, class II antigen E beta2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6361196
• Synonyms: H2-Eb2^em1(IMPC)J
• Gene: H2-Eb2 Location: Chr17:34544639-34560386 bp, + strand Genetic Position: Chr17, 17.98 cM
• Alliance: H2-Eb2^b-em1(IMPC)J page
• IMPC: H2-Eb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTTTTCTGGAGCAGTTGA and CAGAAATAACTATGACCTTG, which resulted in a 218 bp deletion beginning at Chromosome 17 position 34,333,301 bp and ending after 34,333,518 bp (GRCm38/mm10). This mutation deletes 218 bp of ENSMUSE00000411205 (exon 2) and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any H2-Eb2 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)