Mir217^em2Uf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mir217^em2Uf
• Name: microRNA 217; endonuclease-mediated mutation 2, University of Florida
• MGI ID: MGI:6361485
• Gene: Mir217 Location: Chr11:28713728-28713835 bp, + strand Genetic Position: Chr11, 16.23 cM
• Alliance: Mir217^em2Uf page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mir217^em2Uf involves 1 genes/genome features (Mir217hg) View all
• CRISPR-targeting of the seed sequence deleted 28 bp (ATACTGCATCAGGAACTGACTGGATAAG). (J:278847)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mir217 Mutation: 0 strains or lines available

References

• Original: J:278847 Sutaria DS, et al., Knockout of Acinar Enriched microRNAs in Mice Promote Duct Formation But Not Pancreatic Cancer. Sci Rep. 2019 Jul 31;9(1):11147
• All: 1 reference(s)