About   Help   FAQ
Bcl7cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Bcl7cem1(IMPC)J
Name: B cell CLL/lymphoma 7C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6362049
Gene: Bcl7c  Location: Chr7:127260626-127307938 bp, - strand  Genetic Position: Chr7, 69.65 cM, cytoband F4
Alliance: Bcl7cem1(IMPC)J page
IMPC: Bcl7c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGATCTAAGAAGCCGG and ACTCTGGCAATGAAGACCCG, which resulted in a 1218 bp deletion beginning at Chromosome 7 position 127,707,019 bp and ending after 127,708,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264459 through ENSMUSE00000203727 (exons 2-4) and 868 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation. There is a 26 bp insertion (GGGCCAAGCTTGCTAGAGTGTCAAAA) at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Bcl7c Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory