Bcl7c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bcl7c^em1(IMPC)J
• Name: B cell CLL/lymphoma 7C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6362049
• Gene: Bcl7c Location: Chr7:127260626-127307938 bp, - strand Genetic Position: Chr7, 69.65 cM, cytoband F4
• Alliance: Bcl7c^em1(IMPC)J page
• IMPC: Bcl7c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGATCTAAGAAGCCGG and ACTCTGGCAATGAAGACCCG, which resulted in a 1218 bp deletion beginning at Chromosome 7 position 127,707,019 bp and ending after 127,708,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264459 through ENSMUSE00000203727 (exons 2-4) and 868 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation. There is a 26 bp insertion (GGGCCAAGCTTGCTAGAGTGTCAAAA) at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bcl7c Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)