Mtg1^em1Ywxu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mtg1^em1Ywxu
• Name: mitochondrial ribosome-associated GTPase 1; endonuclease-mediated mutation 1, Yawei Xu
• MGI ID: MGI:6362669
• Gene: Mtg1 Location: Chr7:139717477-139730699 bp, + strand Genetic Position: Chr7, 85.16 cM
• Alliance: Mtg1^em1Ywxu page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR targeting (oligo1: TAGGGTTATCGAGGTTCATGACGCC and oligo2: AAACCAATAGCTCCAAGTACTGCGG) produced a null allele through a 14 bp deletion. (J:271147)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mtg1 Mutation: 20 strains or lines available

References

• Original: J:271147 Xu D, et al., Novel role of mitochondrial GTPases 1 in pathological cardiac hypertrophy. J Mol Cell Cardiol. 2019 Jan 29;128:105-116
• All: 1 reference(s)