Gtpbp4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gtpbp4^em1(IMPC)Tcp
• Name: GTP binding protein 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6362818
• Synonyms: Gtpbp4^-
• Gene: Gtpbp4 Location: Chr13:9016367-9046119 bp, - strand Genetic Position: Chr13, 3.64 cM, cytoband A1
• Alliance: Gtpbp4^em1(IMPC)Tcp page
• IMPC: Gtpbp4 gene page

Gtpbp4^em1(IMPC)Tcp/Gtpbp4^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1412 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAAGGGAGCTGCTTCTCCGG targeting the 5' side and GGGTTCTCATGATAGCTTAG targeting the 3' side of a critical region. This resulted in a 834-bp del Chr13: 8991436-8992269 with an insertion of 17-bp, TATCATGAGGGGTTCTC, at the repair junction (GRCm38). (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gtpbp4 Mutation: 37 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)