Tcea2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tcea2em1(IMPC)J |
Name: |
transcription elongation factor A (SII), 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6362950 |
Gene: |
Tcea2 Location: Chr2:181322103-181329864 bp, + strand Genetic Position: Chr2, 103.72 cM
|
Alliance: |
Tcea2em1(IMPC)J page
|
IMPC: |
Tcea2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGGGTCCCAAATAGCCATT and GGAGGTTTTCAGGCTGCAGG, which resulted in a 459 bp deletion beginning at Chromosome 2 position 181,683,416 bp and ending after 181,683,874 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001258127 (exon 3) and 353 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 66 amino acids later. There is an additional 10 bp deletion (GCTGCAGGAG) 22 bp after the 459 bp deletion.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|