Atp6v1f^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp6v1f^em1(IMPC)J
• Name: ATPase, H+ transporting, lysosomal V1 subunit F; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6362956
• Synonyms: Atp6v1f^-
• Gene: Atp6v1f Location: Chr6:29467782-29470508 bp, + strand Genetic Position: Chr6, 12.36 cM, cytoband A3
• Alliance: Atp6v1f^em1(IMPC)J page
• IMPC: Atp6v1f gene page

Atp6v1f^em1(IMPC)J/Atp6v1f^em1(IMPC)J embryos exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTTCATGCAGACACAGAG and GCTGGGAGGGGCCTGCCCAA, which resulted in a 899 bp deletion beginning at Chromosome 6 position 29,469,831 bp and ending after 29,470,729 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261029 (exon 2) and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 22 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Atp6v1f Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)