Serpina3i^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serpina3i^em1(IMPC)J
• Name: serine (or cysteine) peptidase inhibitor, clade A, member 3I; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6363554
• Gene: Serpina3i Location: Chr12:104229381-104235631 bp, + strand Genetic Position: Chr12, 53.78 cM, cytoband F1
• Alliance: Serpina3i^em1(IMPC)J page
• IMPC: Serpina3i gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGGTATATTGACAGCTGTC and TTTACAGGCTATTAGAGAGG, which resulted in a 604 bp deletion beginning at Chromosome 12 position 104,266,357 bp and ending after 104,266,960 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001020941 (exon 4) and 330 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 202 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Serpina3i Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)