About   Help   FAQ
Slamf9em1Isha
Endonuclease-mediated Allele Detail
Summary
Symbol: Slamf9em1Isha
Name: SLAM family member 9; endonuclease-mediated mutation 1, Idit Shachar
MGI ID: MGI:6364884
Gene: Slamf9  Location: Chr1:172302927-172305976 bp, + strand  Genetic Position: Chr1, 79.85 cM
Alliance: Slamf9em1Isha page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology using the upstream guide 5ATCATCTGACTGTTAGACGG3 and downstream guide 5ACTCGCTCTGCAATAAACAT3 sequences generated a 211-bp deletion which includes a part of the promoter, the first exon and intron, and most of the second exon. (J:279164)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Slamf9 Mutation:  21 strains or lines available
References
Original:  J:279164 Sever L, et al., SLAMF9 regulates pDC homeostasis and function in health and disease. Proc Natl Acad Sci U S A. 2019 Aug 13;116(33):16489-16496
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/24/2024
MGI 6.24
The Jackson Laboratory