Slamf9^em1Isha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slamf9^em1Isha
• Name: SLAM family member 9; endonuclease-mediated mutation 1, Idit Shachar
• MGI ID: MGI:6364884
• Gene: Slamf9 Location: Chr1:172302927-172305976 bp, + strand Genetic Position: Chr1, 79.85 cM
• Alliance: Slamf9^em1Isha page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using the upstream guide 5ATCATCTGACTGTTAGACGG3 and downstream guide 5ACTCGCTCTGCAATAAACAT3 sequences generated a 211-bp deletion which includes a part of the promoter, the first exon and intron, and most of the second exon. (J:279164)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slamf9 Mutation: 21 strains or lines available

References

• Original: J:279164 Sever L, et al., SLAMF9 regulates pDC homeostasis and function in health and disease. Proc Natl Acad Sci U S A. 2019 Aug 13;116(33):16489-16496
• All: 1 reference(s)