Klhl34^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klhl34^em1(IMPC)J
• Name: kelch-like 34; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6367818
• Gene: Klhl34 Location: ChrX:156601431-156603365 bp, + strand Genetic Position: ChrX, 72.76 cM
• Alliance: Klhl34^em1(IMPC)J page
• IMPC: Klhl34 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGAGGCATCCCATAACA and TAAGGAGGTGAACAAGGCCT, which resulted in a 1657 bp deletion beginning at Chromosome X position 157,818,351 bp and ending after 157,820,007 bp (GRCm38/mm10). This mutation deletes 1572 bp of ENSMUSE00000543784 (exon 1) and 83 bp upstream of the ATG start and is predicted to generate a null allele. There is a 6 bp insertion TCCAGC at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Klhl34 Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)