Cct7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cct7^em1(IMPC)J
• Name: chaperonin containing TCP1 subunit 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6367820
• Synonyms: Cct7^-
• Gene: Cct7 Location: Chr6:85428496-85445457 bp, + strand Genetic Position: Chr6, 37.46 cM, cytoband D1
• Alliance: Cct7^em1(IMPC)J page
• IMPC: Cct7 gene page

Cct7^em1(IMPC)J/Cct7^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCCTGAGAGTTTCCCAAG and TTTGATGTAAAACATGAAAG, which resulted in a 332 bp deletion beginning at Chromosome 6 position 85,461,376 bp and ending after 85,461,707 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000194312 (exon 5) and 279 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 131 and early truncation 31 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cct7 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)