Ttk^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttk^em1(IMPC)J
• Name: Ttk protein kinase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6367822
• Synonyms: Ttk^-
• Gene: Ttk Location: Chr9:83716742-83754442 bp, + strand Genetic Position: Chr9, 45.61 cM
• Alliance: Ttk^em1(IMPC)J page
• IMPC: Ttk gene page

Ttk^em1(IMPC)J/Ttk^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro hatch from the zona pellucida and form outgrowths with apparent trophectoderm and primitive endoderm cells, but small inner cell mass.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACACCCACAAGAAACCCTGT and GATCCCTCAGAGTTACAGTT, which resulted in a 511 bp deletion beginning at Chromosome 9 position 83,839,051 bp and ending after 83,839,561 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000474185 (exon 3) and 297 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 48 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ttk Mutation: 53 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)