About   Help   FAQ
Sptbem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sptbem1(IMPC)J
Name: spectrin beta, erythrocytic; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6367831
Synonyms: Sptb-
Gene: Sptb  Location: Chr12:76627262-76757321 bp, - strand  Genetic Position: Chr12, 33.73 cM
Alliance: Sptbem1(IMPC)J page
IMPC: Sptb gene page
Sptbem1(IMPC)J/Sptbem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida and are dead after 72hr in vitro, never forming outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATTGGGATACAGGAAGAG and CCCACCACACTTCAGAAATG, which resulted in a 1369 bp deletion beginning at Chromosome 12 position 76,620,406 bp and ending after 76,621,774 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000114246 (exon 14) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 599 and early truncation 7 amino acids later. There is a 2 bp insertion (AC) at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sptb Mutation:  85 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory