Tpx2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tpx2^em1(IMPC)J
• Name: TPX2, microtubule-associated; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6367835
• Gene: Tpx2 Location: Chr2:152689884-152737241 bp, + strand Genetic Position: Chr2, 75.41 cM, cytoband H2
• Alliance: Tpx2^em1(IMPC)J page
• IMPC: Tpx2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTCTGCAGTAGTCTGACT and GTTTATGGATTGTAGCTTGC, which resulted in a 253 bp deletion beginning at Chromosome 2 position 152,873,064 bp and ending after 152,873,316 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001204719 (exon 5) and 126 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 24 amino acids later. There is a 3 bp insertion (AGA) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tpx2 Mutation: 110 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)