Fndc3a^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fndc3a^em1(IMPC)Tcp
• Name: fibronectin type III domain containing 3A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6367979
• Gene: Fndc3a Location: Chr14:72775386-72947443 bp, - strand Genetic Position: Chr14, 37.62 cM
• Alliance: Fndc3a^em1(IMPC)Tcp page
• IMPC: Fndc3a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1411 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CAGCAGGATGCTCTATGTCC targeting the 5' side and CTAATTACCCTGTCAGATGA targeting the 3' side of a critical region. This resulted in a 653-bp deletion Chr14:72574174-72574826 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fndc3a Mutation: 69 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)