Rr172^em1Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr172^em1Kmm
• Name: regulatory region 172; endonuclease-mediated mutation 1, Kenneth Murphy
• MGI ID: MGI:6368518
• Synonyms: Irf8 +32^-, Irf8^em1Kmm
• Gene: Rr172 Location: Chr8:121495079-121495626 bp Genetic Position: Chr8, Syntenic
• Alliance: Rr172^em1Kmm page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Plasmids encoding sgRNA (gttgtgatctttgaggtaga, gtctccttctgaaatttcagtt, and gaactggcctggggcaggtc) are designed to delete one of two enhancers located in the super-enhancer of the gene +32 kb downstream from the transcriptional start site. The 421 bp deletion results in elimination all four AP1-IRF composite elements (AICEs) in the +32-kb Irf8 enhancer. (J:279982)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rr172 Mutation: 0 strains or lines available

References

• Original: J:279982 Durai V, et al., Cryptic activation of an Irf8 enhancer governs cDC1 fate specification. Nat Immunol. 2019 Sep;20(9):1161-1173
• All: 11 reference(s)