Irf8^em2Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Irf8^em2Kmm
• Name: interferon regulatory factor 8; endonuclease-mediated mutation 2, Kenneth Murphy
• MGI ID: MGI:6368522
• Synonyms: Irf8 +41^-, Rr173^em2Kmm
• Gene: Irf8 Location: Chr8:121463097-121483433 bp, + strand Genetic Position: Chr8, 70.05 cM
• Alliance: Irf8^em2Kmm page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Plasmids encoding sgRNA (ggcccttgtagtttagctta and aaagaagatctggggtatgt), designed to delete one of two enhancers located in the super-enhancer of the gene +41 kb downstream from the transcriptional start site. The 361 bp deletion eliminates all six predicted E-box motifs in the +41-kb Irf8 enhancer. (J:279982)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Irf8 Mutation: 32 strains or lines available

References

• Original: J:279982 Durai V, et al., Cryptic activation of an Irf8 enhancer governs cDC1 fate specification. Nat Immunol. 2019 Sep;20(9):1161-1173
• All: 3 reference(s)