Echdc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Echdc1^em1(IMPC)J
• Name: enoyl Coenzyme A hydratase domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6376198
• Synonyms: Echdc1^-
• Gene: Echdc1 Location: Chr10:29189162-29223465 bp, + strand Genetic Position: Chr10, 16.59 cM
• Alliance: Echdc1^em1(IMPC)J page
• IMPC: Echdc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTATTTAGGTAGAAAAAT and AGTTATAGTACTAAGCACAC, which resulted in a 458 bp deletion beginning at Chromosome 10 position 29,322,031 bp and ending after 29,322,488 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001307826 (exon 3) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 42 amino acids later. There is a 10 bp insertion (TTATAGTACT) at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Echdc1 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)