Wdr25^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr25^em1(IMPC)J
• Name: WD repeat domain 25; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6376207
• Synonyms: Wdr25^-
• Gene: Wdr25 Location: Chr12:108860155-108994380 bp, + strand Genetic Position: Chr12, 59.7 cM
• Alliance: Wdr25^em1(IMPC)J page
• IMPC: Wdr25 gene page

Wdr25^em1(IMPC)J/Wdr25^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGCAGACTGTCGAAGGCAG and CAAATGATCTGCATGCCCGT, which resulted in a 672 bp deletion beginning at Chromosome 12 position 108,980,296 bp and ending after 108,980,967 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000879483 (exon 4) and 524 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 265 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wdr25 Mutation: 48 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)