Ube2q2l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ube2q2l^em1(IMPC)J
• Name: ubiquitin conjugating enzyme E2 Q2 like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6376261
• Gene: Ube2q2l Location: Chr6:136377315-136392567 bp, - strand Genetic Position: Chr6, 66.59 cM
• Alliance: Ube2q2l^em1(IMPC)J page
• IMPC: Ube2q2l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACACCATAGCAACTGCACAA and GATGGATTCTCCATGCTAAA, which resulted in a 1677 bp deletion beginning at Chromosome 6 position 136,400,277 bp and ending after 136,401,953 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001369384 (exon 2) and 107 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ube2q2l Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)