About   Help   FAQ
Tsen54em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tsen54em1(IMPC)J
Name: tRNA splicing endonuclease subunit 54; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6377433
Synonyms: Tsen54-
Gene: Tsen54  Location: Chr11:115705550-115713920 bp, + strand  Genetic Position: Chr11, 80.91 cM, cytoband E2
Alliance: Tsen54em1(IMPC)J page
IMPC: Tsen54 gene page
Tsen54em1(IMPC)J/Tsen54em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as morulae but not at E7.5. Mutants fail to hatch from the zona pellucida and are dead after 72 hr in vitro outgrowth culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAAATCCCATCTACGGTGG and GAAAGTGGATGCTTAGACGA, which resulted in a 1008 bp deletion beginning at Chromosome 11 position 115,820,077 bp and ending after 115,821,084 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001304729 and ENSMUSE00000109206 (exons 7 and 8) and 280 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 174 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tsen54 Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory