Adamts16^em1Amc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adamts16^em1Amc
• Name: ADAM metallopeptidase with thrombospondin type 1 motif 16; endonuclease-mediated mutation 1, Andrew P McMahon
• MGI ID: MGI:6377449
• Gene: Adamts16 Location: Chr13:70875921-70989930 bp, - strand Genetic Position: Chr13, 35.97 cM
• Alliance: Adamts16^em1Amc page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 33 base pair deletion (CTGTGAGCCCTCGGGCACCGGGGCCATGGAGTC) in exon 1, removing the initiation methionine. (J:280280)

Expression

In Mice Carrying this Mutation:

7 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Adamts16 Mutation: 84 strains or lines available

References

• Original: J:280280 Rutledge EA, et al., Morphogenesis of the kidney and lung requires branch-tip directed activity of the Adamts18 metalloprotease. Dev Biol. 2019 Oct 15;454(2):156-169
• All: 1 reference(s)