Galntl6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Galntl6^em1(IMPC)J
• Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6377462
• Gene: Galntl6 Location: Chr8:58227086-59365674 bp, - strand Genetic Position: Chr8, 30.72 cM
• Alliance: Galntl6^em1(IMPC)J page
• IMPC: Galntl6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAACATTGGTAATCAACAA and TTTATGGCTGGAGTTGTGGG, which resulted in a 459 bp deletion beginning at Chromosome 8 position 58,535,773 bp and ending after 58,536,231 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001303502 (exon 3) and 350 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 35 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Galntl6 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)