Eva1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eva1a^em1(IMPC)J
• Name: eva-1 homolog A, regulator of programmed cell death; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6377661
• Gene: Eva1a Location: Chr6:82018058-82070079 bp, + strand Genetic Position: Chr6, 35.81 cM
• Alliance: Eva1a^em1(IMPC)J page
• IMPC: Eva1a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTCTCTATGTAAGGTCA and GTATGACCTCTGCAGGACTC, which resulted in a 1441 bp deletion beginning at Chromosome 6 position 82,091,741 bp and ending after 82,093,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000366139 (exon 3) and 135 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 3 amino acids later. There is a 1 bp (A) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eva1a Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)