Polr2g^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr2g^em1(IMPC)J
• Name: polymerase (RNA) II (DNA directed) polypeptide G; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6378226
• Gene: Polr2g Location: Chr19:8770493-8775921 bp, - strand Genetic Position: Chr19, 5.62 cM
• Alliance: Polr2g^em1(IMPC)J page
• IMPC: Polr2g gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTCATAGAAAGGTTATG and TCAATGAACCATCTGAACAG, which resulted in a 480 bp deletion beginning at Chromosome 19 position 8,797,208 bp and ending after 8,797,687 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000621714 (exon 3) and 320 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 41 amino acids later. There is a single bp insertion A at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Polr2g Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)