Morn5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Morn5^em1(IMPC)J
• Name: MORN repeat containing 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6379285
• Gene: Morn5 Location: Chr2:35939485-35969721 bp, + strand Genetic Position: Chr2, 24.15 cM, cytoband B
• Alliance: Morn5^em1(IMPC)J page
• IMPC: Morn5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGCGATGCATCTGAGGA and GATTGGGCAGAATGAAACAT, which resulted in a 327 bp deletion beginning at Chromosome 2 position 36,052,858 bp and ending after 36,053,184 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000257467 (exon 2) and 179 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 33 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Morn5 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)