U2af2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: U2af2^em1(IMPC)J
• Name: U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6379288
• Synonyms: U2af2^-
• Gene: U2af2 Location: Chr7:5065142-5082937 bp, + strand Genetic Position: Chr7, 2.93 cM, cytoband A1
• Alliance: U2af2^em1(IMPC)J page
• IMPC: U2af2 gene page

U2af2^em1(IMPC)J/U2af2^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and are dead after 72 hr in vitro outgrowth culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTAGGTCAACTAAGTTACG and ACTCTAGCTGGACTAAGTAC, which resulted in a 486 bp deletion beginning at Chromosome 7 position 5,070,084 bp and ending after 5,070,569 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000198884 (exon 7) and 347 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 201 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any U2af2 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)