Yif1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Yif1a^em1(IMPC)J
• Name: Yip1 interacting factor homolog A (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6379294
• Gene: Yif1a Location: Chr19:5138566-5142907 bp, + strand Genetic Position: Chr19, 4.24 cM, cytoband A
• Alliance: Yif1a^em1(IMPC)J page
• IMPC: Yif1a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAGTCGAGAGGCGCACCG and TTAAAGTCACTGGCTCCAAG, which resulted in a 646 bp deletion beginning at Chromosome 19 position 5,091,215 bp and ending after 5,091,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145739 and ENSMUSE00000145750 (exons 5 and 6) and 432 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 142 and early truncation 1 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Yif1a Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)