Twist1^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Twist1^{em1(IMPC)Rbrc}
• Name: twist basic helix-loop-helix transcription factor 1; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6379556
• Gene: Twist1 Location: Chr12:34007670-34009828 bp, + strand Genetic Position: Chr12, 14.81 cM, cytoband B-C1
• Alliance: Twist1^{em1(IMPC)Rbrc} page
• IMPC: Twist1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele from IMPC was generated at RIKEN BioResource Research Center by injecting CAS9 Protein and 2 guide sequences CAAACTTTCCGCCCGCACGGAGG, TAACTCTAGGGGCATCTAGGAGG, which resulted in a Whole-gene deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Twist1 Mutation: 18 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)