Amigo2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Amigo2^em1(IMPC)J
• Name: adhesion molecule with Ig like domain 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6380687
• Gene: Amigo2 Location: Chr15:97142006-97145168 bp, - strand Genetic Position: Chr15, 52.91 cM
• Alliance: Amigo2^em1(IMPC)J page
• IMPC: Amigo2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTTGTGGCATCCACTTAGC and TTGACAGCTCTAGGCAGGGT, which resulted in a 1531 bp deletion beginning at Chromosome 15 position 97,244,981 bp and ending after 97,246,511 bp (GRCm38/mm10). This mutation deletes 1531 bp of ENSMUSE00000505071 (exon 2) and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 23 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Amigo2 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)