Jakmip2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Jakmip2^em1(IMPC)J
• Name: janus kinase and microtubule interacting protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6381361
• Gene: Jakmip2 Location: Chr18:43664472-43820838 bp, - strand Genetic Position: Chr18, 23.36 cM
• Alliance: Jakmip2^em1(IMPC)J page
• IMPC: Jakmip2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAACGGGATATACGGAGGC and AGCAAAGAGGATTCGTGAGT, which resulted in a 444 bp deletion beginning at Chromosome 18 position 43,581,839 bp and ending after 43,582,282 bp (GRCm38/mm10). This mutation deletes 444 bp of ENSMUSE00000659470 (exon 1) and is predicted to cause a change of amino acid sequence after residue 59 and an immediate stop. There is a 1 bp (T) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Jakmip2 Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)