Lysmd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lysmd1^em1(IMPC)J
• Name: LysM, putative peptidoglycan-binding, domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6381415
• Gene: Lysmd1 Location: Chr3:95041399-95046829 bp, + strand Genetic Position: Chr3, 40.74 cM, cytoband F2
• Alliance: Lysmd1^em1(IMPC)J page
• IMPC: Lysmd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGAAAACAGTGTACTTGG and AGAAGTAACCAAAGTACCCG, which resulted in a 614 bp deletion beginning at Chromosome 3 position 95,137,456 bp and ending after 95,138,069 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000422932 (exon 2) and 252 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 60 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lysmd1 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)